G.T.A. San Andreas segítség a végigjátszásban :D Kódok, térképek, és sok érdekesség !!! + 2011-től GTA4 és Vice City !!
G.T.A. San Andreas segítség a végigjátszásban :D Kódok, térképek, és sok érdekesség !!! + 2011-től GTA4 és Vice City !!
San Andreas
 
Küldetések
 
GTA 4
 
Vice City
 
Liberty City Stories
 
Naptár
2015. Március
HKSCPSV
23
24
25
26
27
28
01
02
03
04
05
06
07
08
09
10
11
12
13
14
15
16
17
18
19
20
21
22
23
24
25
26
27
28
29
30
31
01
02
03
04
<<   >>
 
Bejelentkezés
Felhasználónév:

Jelszó:
SúgóSúgó
Regisztráció
Elfelejtettem a jelszót
 
Szavazz!
Azért vagyok itt...

...mert nem tudom végigvinni a játékot, kell segítség
...mert már végigvittem, de a 100% nem jön össze
...mert kíváncsi vagyok mit rejteget még a GTA
...mert véletlen rákattintottam erre
...mert unatkoztam
...mert jó a tarsaság
egyéb
Szavazás állása
Lezárt szavazások
 
Kérésed IDE ird!
[286-267] [266-247] [246-227] [226-207] [206-187] [186-167] [166-147] [146-127] [126-107] [106-87] [86-67] [66-47] [46-27] [26-7] [6-1]

2015.01.08. 18:28 Idézet
haljatok meg anyátokban ti kurvá

anyát o ka   t   er r ea  szarol da lg ec ivrebb v


2015.01.01. 19:35 Idézet
Sziasztok! Meg tudnátok nekem mondani hogy ps2-őn a két személyes piros jelet hol találom (azt amelyikben csak ugy vagyunk nem azt ahol öldösni kel az embereket)
2015.01.01 19:33
Máté
Sziasztok! Meg tudnátok nekem mondani hogy ps2-őn a két személyes piros jelet (azt. amelyikben csak ugy vagyunk nem azt ahol öldösni kel az embereket)

2015.01.01. 19:33 Idézet
Sziasztok! Meg tudnátok nekem mondani hogy ps2-őn a két személyes piros jelet (azt. amelyikben csak ugy vagyunk nem azt ahol öldösni kel az embereket)

2014.12.29. 14:23 Idézet
peti

Rájöttem hogy én voltam a buta, nem húztam vissza a kerekeket felszállás után...


2014.12.29 09:10
Peti

„ Sziasztok!

 

A repülőiskolánál elakagtam, az első 2 feladat megvan azonban a 3adiknál közvetlenül felszállás után egyszerűen nem tudom olyan magasra juttatni a gépet hogy elérje a karikát kb a magasság feléig jutok, amikor a gép motorja elkezd fulladozni és nem emelkedik tovább.

Már próbáltam extragyorsan és extralassan is az emelkedést de akkor is csak ugyanaddig emelkedik a gép...

Ki nem állhatom amúgy a repülős küldetéseket, kár hogy e nélkül nem lehet tovább vinni a kalandsort...


2014.12.29. 09:10 Idézet
Peti

Sziasztok!

 

A repülőiskolánál elakagtam, az első 2 feladat megvan azonban a 3adiknál közvetlenül felszállás után egyszerűen nem tudom olyan magasra juttatni a gépet hogy elérje a karikát kb a magasság feléig jutok, amikor a gép motorja elkezd fulladozni és nem emelkedik tovább.

Már próbáltam extragyorsan és extralassan is az emelkedést de akkor is csak ugyanaddig emelkedik a gép...

Ki nem állhatom amúgy a repülős küldetéseket, kár hogy e nélkül nem lehet tovább vinni a kalandsort...


2014.12.27. 10:26 Idézet

Sziasztok!

olyan kérdésem lenne, hogy amikor torino-z kiszabadítom és a limoval kell menni, nekem a híd alá jelöli hogy menni kell amikor ott vagyok a piros karika eltűnik de a sárga jel ott marad és nem jelez tovább utat,, ott mit kell csinálni?


2014.11.10. 15:09 Idézet
kurva

kol tali gokartiak mi te kocsog gtagtagta pusztulj el te rokadt kurifasz


2014.11.08. 00:57 Idézet

Figyu hol találhato a gokart


2014.11.08. 00:51 Idézet

Figyu hol találhato a gokart


2014.10.31. 14:04 Idézet
gtttttttaaaagtttaagggggttttttaaa

fak cj


2014.10.31. 14:02 Idézet
prosti,állatok,vagytok,

sex cj kocsi  mozog


2014.10.31. 13:53 Idézet
gtagtagta

cj

 

 

ridy bigismok

ingsvetterson


2014.10.31. 13:49 Idézet
rozsradekasdáélaskihf

hali én vagyok az ÚJ segitségg.


2014.10.30. 14:42 Idézet
lázsló2

fakk kula tudja


2009.06.07 11:57
Závoczki Lászlo

„Helloa kérdésem az lenne: hol található ''Ds'' nevű ruhabolt?”


2014.10.30. 14:41 Idézet
kitreeeeas

lúúúúzer vagy!!!!!!!


2014.07.05 19:31
dragalaslo

„ Sziasztok! Az lenne a kérdésem, hogy miért történik az, hogy nincs meg San Fierro-ban az összes fénykép helye, La Venturas-ban nincs meg egy patkó. 2.00-s eredeti lemezes SA-m van... köszönöm a választ előre is! :)


2014.10.30. 14:39 Idézet
kirtadsvwstzd

gtagtagta fos kula vagy


2014.10.30. 14:37 Idézet
fak gta

gtagtagta nem írsz senki üziére


2014.10.30. 14:35 Idézet
gtagtagta

LUZI vagy hülyeségeket irsz


2009.06.02 15:14
gtagtagta

„az éttermek helye című menüpontban minden nagy helynév szerepel”


2014.10.30. 14:34 Idézet
senkiházi

hülyeségeket ÍÍÍÍrssszzzzz


2009.06.02 15:12
gtagtagta

„mondjuk a menüpontoknak felében. xD”


2014.10.30. 14:32 Idézet
kula prosti taálakula

várd meg még beül egy prosti melléd és lassan menjél .....................???????++++++++!!!!!!!!%+Z%/%//+%!+


[286-267] [266-247] [246-227] [226-207] [206-187] [186-167] [166-147] [146-127] [126-107] [106-87] [86-67] [66-47] [46-27] [26-7] [6-1]

 
Menü
 
Extrák
 
Clock
 
Lélekszámláló
Indulás: 2008-09-08
 
Chat
Név:

Üzenet:
:)) :) :@ :? :(( :o :D ;) 8o 8p 8) 8| :( :'( ;D :$
 
Szavazz!!
Milyen az oldal?

Tök jó!!!
Jó..:)
Elmegy
Nem valami jó...
Szar
Szavazás állása
Lezárt szavazások
 
Kérések
 

VANESSA HUDGENS! VANESSA HUDGENS! VANESSA HUDGENS! VANESSA HUDGENS! VANESSA HUDGENS! VANESSA HUDGENS! VANESSA HUDGENS!    *****    Friss hírek minden nap Az uralkodónõ címû epizódról! REIGNWEB // REIGNWEB // REIGNWEB // REIGNWEB // REIGNWEB // REIGNWE    *****    Születési horoszkóp,ajándék 3 éves elõrejelzéssel,párkapcsolati elemzés,fogamzási képlet,biotérkép rendelj most!    *****    *MÁRCIUSI NYEREMÉNYJÁTÉK* "IDE MINDIG ÉRDEMES BENÉZNI!" Picur Mini ABC Nyitva:mindennap 5-21h-ig Bp. IV. Nádor u. 87    *****    Star Stable Online - Blog, segítségek, és sok minden más. Nézz be :)    *****    Video link megosztó oldal! Ha van tárhelyeden videód itt ingyen megoszthatód mindenkivel.    *****    Új blogot nyitottam, személyes-divat-kritika témákkal foglalkozom, idõvel minden helyre áll, addig is nézzetek be ;)Katt    *****    Nézzetek be a gportál egyetlen mûködõ Reignnel foglalkozó honlapjára! Mindennapos frissek és érdekességek // REIGN //    *****    Születési horoszkóp,ajándék 3 éves elõrejelzéssel,párkapcsolati elemzés,fogamzási képlet,biotérkép rendelj most!    *****    MEGNYITOTTUNK!! ODAÁT - SUPERNATURAL RAJONGÓI OLDAL! RENGETEG EXTRA, CIKK ÉS ÉRDEKESSÉG!! SUPERNATURAL! ODAÁT OLDAL    *****    Rendelj születési horoszkópot, ajándék 3 éves elõrejelzést, párkapcsolati elemzést,fogamzási képletet, biotérképet most!    *****    Új kinézet került fel a gportál egyetlen mûködõ Reign.nel foglalkozó honlapjára! REIGNWEB // REIGNWEB // REIGNWEB //    *****    Új Design! Új Design! Gaby Espino Hungary - Gyere és ismerd meg a népszerû színésznõt! - Új Design! Várom a véleményed!    *****    Új kinézet került fel a gportál egyetlen mûködõ Reign.nel foglalkozó honlapjára! REIGNWEB // REIGNWEB // REIGNWEB //    *****    Egyedi kézmûves PATCHWORK termékek, csak nálam!!takarók, táskák,apró szépségek.. minden ami textil    *****    fantasy rajzok, történetek * fantasy rajzok, történetek *fantasy rajzok, történetek *fantasy rajzok, történetek *fantasy    *****    Sziasztok ! Ha érdekel a divat és minden ami beauty akkor látogass el az oldalamra,hogy ne maradj le semmirõl ;)    *****    Új kinézet került fel a gportál egyetlen mûködõ Reign.nel foglalkozó honlapjára! REIGNWEB // REIGNWEB // REIGNWEB //    *****    Amatõr fotóim, egy helyen! Nézz be, az oldalamra, és mondj véleményt, képeimrõl! Akár amatõr, akár szakmai szemmel!    *****    Készíts egy vagy több fekete-fehér fotót, és nyerj! A téma kötetlen, így nincs nehéz dolgod, igaz? :)