G.T.A. San Andreas segítség a végigjátszásban :D Kódok, térképek, és sok érdekesség !!! + 2011-től GTA4 és Vice City !!
G.T.A. San Andreas segítség a végigjátszásban :D Kódok, térképek, és sok érdekesség !!! + 2011-től GTA4 és Vice City !!
San Andreas
 
Küldetések
 
GTA 4
 
Vice City
 
Liberty City Stories
 
Naptár
2015. Szeptember
HKSCPSV
31
01
02
03
04
05
06
07
08
09
10
11
12
13
14
15
16
17
18
19
20
21
22
23
24
25
26
27
28
29
30
01
02
03
04
<<   >>
 
Bejelentkezés
Felhasználónév:

Jelszó:
SúgóSúgó
Regisztráció
Elfelejtettem a jelszót
 
Szavazz!
Azért vagyok itt...

...mert nem tudom végigvinni a játékot, kell segítség
...mert már végigvittem, de a 100% nem jön össze
...mert kíváncsi vagyok mit rejteget még a GTA
...mert véletlen rákattintottam erre
...mert unatkoztam
...mert jó a tarsaság
egyéb
Szavazás állása
Lezárt szavazások
 
Kérésed IDE ird!
[294-275] [274-255] [254-235] [234-215] [214-195] [194-175] [174-155] [154-135] [134-115] [114-95] [94-75] [74-55] [54-35] [34-15] [14-1]

2015.06.10. 17:24 Idézet
alexxx

Pont most vettem eszre.


2015.06.10. 17:23 Idézet
alexxx

Ez meg melyik marha volt??????


2015.06.10. 17:21 Idézet
gecik

dogoljetek meg ti kurvak!!!!!!!!!!!!!!!!!!!AAAAAAAAAAAAAAAHHHHHHHHHHHHHHHHH


2015.03.29. 08:20 Idézet
alex

En is rajottem Peti ,nem vettem eszre , hogy te irtad:D es megcsinaltad.


2015.03.29. 08:19 Idézet
alex

                                                    Kedves Peti

A gepet ne egybol emeld fel olyan magasra , hanem lassacskan.Egy picit emeld egy picit gyorsuljon fel es utana semmi eselye nem lesz , hogy lezuhanjon.Ha nem jol mondtam , akkor irj. 

                                                                                       


2015.03.29. 08:05 Idézet
alex

Nekem nem kell segitseg, csak nektek.:D

Ha van san andreas multiplayer-rel is gondotok azt is elfogadom.

                                                       Csak G.T.A!!!!!!!!!!!!      


2015.03.29. 08:02 Idézet
alex

Nem tudok ekezettel irni bocs.

En GTA San Andreas bolond vagyok , tehat en sok erdekesseget tudok ezzel kapcsolatba.

Szeretnek sok erdekesseget bemutatni a gta-val kapcsolatosan.Ha akartok sokmindent megtudni akkor csak irjatok .


2015.03.29. 07:58 Idézet

Sziasztok!!!!!                                          


2015.01.08. 18:28 Idézet
haljatok meg anyátokban ti kurvá

anyát o ka   t   er r ea  szarol da lg ec ivrebb v


2015.01.01. 19:35 Idézet
Sziasztok! Meg tudnátok nekem mondani hogy ps2-őn a két személyes piros jelet hol találom (azt amelyikben csak ugy vagyunk nem azt ahol öldösni kel az embereket)
2015.01.01 19:33
Máté
Sziasztok! Meg tudnátok nekem mondani hogy ps2-őn a két személyes piros jelet (azt. amelyikben csak ugy vagyunk nem azt ahol öldösni kel az embereket)

2015.01.01. 19:33 Idézet
Sziasztok! Meg tudnátok nekem mondani hogy ps2-őn a két személyes piros jelet (azt. amelyikben csak ugy vagyunk nem azt ahol öldösni kel az embereket)

2014.12.29. 14:23 Idézet
peti

Rájöttem hogy én voltam a buta, nem húztam vissza a kerekeket felszállás után...


2014.12.29 09:10
Peti

„ Sziasztok!

 

A repülőiskolánál elakagtam, az első 2 feladat megvan azonban a 3adiknál közvetlenül felszállás után egyszerűen nem tudom olyan magasra juttatni a gépet hogy elérje a karikát kb a magasság feléig jutok, amikor a gép motorja elkezd fulladozni és nem emelkedik tovább.

Már próbáltam extragyorsan és extralassan is az emelkedést de akkor is csak ugyanaddig emelkedik a gép...

Ki nem állhatom amúgy a repülős küldetéseket, kár hogy e nélkül nem lehet tovább vinni a kalandsort...


2014.12.29. 09:10 Idézet
Peti

Sziasztok!

 

A repülőiskolánál elakagtam, az első 2 feladat megvan azonban a 3adiknál közvetlenül felszállás után egyszerűen nem tudom olyan magasra juttatni a gépet hogy elérje a karikát kb a magasság feléig jutok, amikor a gép motorja elkezd fulladozni és nem emelkedik tovább.

Már próbáltam extragyorsan és extralassan is az emelkedést de akkor is csak ugyanaddig emelkedik a gép...

Ki nem állhatom amúgy a repülős küldetéseket, kár hogy e nélkül nem lehet tovább vinni a kalandsort...


2014.12.27. 10:26 Idézet

Sziasztok!

olyan kérdésem lenne, hogy amikor torino-z kiszabadítom és a limoval kell menni, nekem a híd alá jelöli hogy menni kell amikor ott vagyok a piros karika eltűnik de a sárga jel ott marad és nem jelez tovább utat,, ott mit kell csinálni?


2014.11.10. 15:09 Idézet
kurva

kol tali gokartiak mi te kocsog gtagtagta pusztulj el te rokadt kurifasz


2014.11.08. 00:57 Idézet

Figyu hol találhato a gokart


2014.11.08. 00:51 Idézet

Figyu hol találhato a gokart


2014.10.31. 14:04 Idézet
gtttttttaaaagtttaagggggttttttaaa

fak cj


2014.10.31. 14:02 Idézet
prosti,állatok,vagytok,

sex cj kocsi  mozog


2014.10.31. 13:53 Idézet
gtagtagta

cj

 

 

ridy bigismok

ingsvetterson


[294-275] [274-255] [254-235] [234-215] [214-195] [194-175] [174-155] [154-135] [134-115] [114-95] [94-75] [74-55] [54-35] [34-15] [14-1]

 
Menü
 
Extrák
 
Clock
 
Lélekszámláló
Indulás: 2008-09-08
 
Chat
Név:

Üzenet:
:)) :) :@ :? :(( :o :D ;) 8o 8p 8) 8| :( :'( ;D :$
 
Szavazz!!
Milyen az oldal?

Tök jó!!!
Jó..:)
Elmegy
Nem valami jó...
Szar
Szavazás állása
Lezárt szavazások
 
Kérések
 

szilveszteri tûzijáték    *****    *SZEPTEMBERI NYEREMÉNYJÁTÉK* "IDE MINDIG ÉRDEMES BENÉZNI!" Picur Mini ABC Nyitva:mindennap 5-21h-ig Bp. IV. Nádor u. 87    *****    Új design, új bejegyzések, új tanév...    *****    Magyarország hivatalos Olicitys honlapja és legaktívabb Arrow honlapja! 4. évados spoilerek és mindent a párosunkról!    *****    Sweetfairytale AGAIN! Folytatódik a tündérmese, élén új szerkesztõvel! Ha blogot olvasnál vagy kritikát, esetleg grafikát keresel a lapodhoz, mindenképp nézz be! :)    *****    ÁGICA KALANDJAI -> az életbõl kapja és adja ihletet, képekkel és videókkal!    *****    Találsz nálam írásokat fandomokon innen és túl, saját grafikát, egy kevés bármit, és apránként mindbõl egyre többet.    *****    DOUBLEVISION >> leírások, design és grafikai kellékek! DOUBLEVISION >> leírások, design és grafikai kellékek! DOUBLEVISI    *****    Újranyitás! Nyereményjáték! Ismerd meg a Tudorokat! Magyarország egyetlen mûködõ, Tudor-korral foglalkozó oldala!    *****    NEM OSZLIK FEL A 1D! Ha hiteles információkat szeretnél a One Directionrõl, nézz be a 1DFANS-re! | NEM OSZLIK FEL A 1D!    *****    Tudj meg mindent a Reign címû sorozatról! // Friss hírek, érdekességek, extrák // KATT // REIGNWEB // REIGNWEB    *****    Egy igazán egyedi rajongói lapra vágysz? Akkor ilyet még biztosan nem láttál! Tévés párosok birodalma vár! Katt!    *****    Találsz nálam írásokat fandomokon innen és túl, okoskodást, recepteket, saját grafikát és apránként mindbõl egyre többet    *****    SZERETED AZ ÁLLATOKAT? AKKOR KATT!:DDDD SZERETED AZ ÁLLATOKAT? AKKOR KATT!:DDDD SZERETED AZ ÁLLATOKAT? AKKOR KATT!:DDDD    *****    Ha szeretnél komoly kapcsolatot vagy társat! Itt bisztos meg találód! klikk ide!    *****    Bûbájos boszorkák varázslat, mágia, extrák, kvízjátékok! Tudj meg mindent a sorozatról! Charmed!! Bûbájos boszorkák!    *****    Nézd online: A zöld íjász, Family Guy, The Walking Dead, Trónok Harca, Vámpírnaplók! Ingyen, regisztráció nélkül!    *****    BEAUTYHINTS.GP/Egyedülálló oldal a szépségápolás jegyében!/BEAUTYHINTS.GP/Szépség tippek,termék bemutatók és sok más!    *****    NÉZD MEG A ONE DIRECTION LEGÚJABB VIDEOKLIPJÉT! - 1DFANS - NÉZD MEG A ONE DIRECTION LEGÚJABB VIDEOKLIPJÉT! - 1DFANS    *****    SZEREPJÁTÉK - SHELTER HOUSE újra nyitva, téged is vár a menedékház! - SZEREPJÁTÉK - SHELTER HOUSE - A menedékház