G.T.A. San Andreas segítség a végigjátszásban :D Kódok, térképek, és sok érdekesség !!! + 2011-től GTA4 és Vice City !!
G.T.A. San Andreas segítség a végigjátszásban :D Kódok, térképek, és sok érdekesség !!! + 2011-től GTA4 és Vice City !!
San Andreas
 
Küldetések
 
GTA 4
 
Vice City
 
Liberty City Stories
 
Naptár
2014. November
HKSCPSV
27
28
29
30
31
01
02
03
04
05
06
07
08
09
10
11
12
13
14
15
16
17
18
19
20
21
22
23
24
25
26
27
28
29
30
01
02
03
04
05
06
<<   >>
 
Bejelentkezés
Felhasználónév:

Jelszó:
SúgóSúgó
Regisztráció
Elfelejtettem a jelszót
 
Szavazz!
Azért vagyok itt...

...mert nem tudom végigvinni a játékot, kell segítség
...mert már végigvittem, de a 100% nem jön össze
...mert kíváncsi vagyok mit rejteget még a GTA
...mert véletlen rákattintottam erre
...mert unatkoztam
...mert jó a tarsaság
egyéb
Szavazás állása
Lezárt szavazások
 
Kérésed IDE ird!
[280-261] [260-241] [240-221] [220-201] [200-181] [180-161] [160-141] [140-121] [120-101] [100-81] [80-61] [60-41] [40-21] [20-1]

2014.11.10. 15:09 Idézet
kurva

kol tali gokartiak mi te kocsog gtagtagta pusztulj el te rokadt kurifasz


2014.11.08. 00:57 Idézet

Figyu hol találhato a gokart


2014.11.08. 00:51 Idézet

Figyu hol találhato a gokart


2014.10.31. 14:04 Idézet
gtttttttaaaagtttaagggggttttttaaa

fak cj


2014.10.31. 14:02 Idézet
prosti,állatok,vagytok,

sex cj kocsi  mozog


2014.10.31. 13:53 Idézet
gtagtagta

cj

 

 

ridy bigismok

ingsvetterson


2014.10.31. 13:49 Idézet
rozsradekasdáélaskihf

hali én vagyok az ÚJ segitségg.


2014.10.30. 14:42 Idézet
lázsló2

fakk kula tudja


2009.06.07 11:57
Závoczki Lászlo

„Helloa kérdésem az lenne: hol található ''Ds'' nevű ruhabolt?”


2014.10.30. 14:41 Idézet
kitreeeeas

lúúúúzer vagy!!!!!!!


2014.07.05 19:31
dragalaslo

„ Sziasztok! Az lenne a kérdésem, hogy miért történik az, hogy nincs meg San Fierro-ban az összes fénykép helye, La Venturas-ban nincs meg egy patkó. 2.00-s eredeti lemezes SA-m van... köszönöm a választ előre is! :)


2014.10.30. 14:39 Idézet
kirtadsvwstzd

gtagtagta fos kula vagy


2014.10.30. 14:37 Idézet
fak gta

gtagtagta nem írsz senki üziére


2014.10.30. 14:35 Idézet
gtagtagta

LUZI vagy hülyeségeket irsz


2009.06.02 15:14
gtagtagta

„az éttermek helye című menüpontban minden nagy helynév szerepel”


2014.10.30. 14:34 Idézet
senkiházi

hülyeségeket ÍÍÍÍrssszzzzz


2009.06.02 15:12
gtagtagta

„mondjuk a menüpontoknak felében. xD”


2014.10.30. 14:32 Idézet
kula prosti taálakula

várd meg még beül egy prosti melléd és lassan menjél .....................???????++++++++!!!!!!!!%+Z%/%//+%!+


2014.10.30. 14:29 Idézet
hunter59 mása hülyeség

ja nem tudom me mert már azt kiakasztottam    


2010.05.29 17:43
hunter59

„segítsetek! a madd dog-os küldinél miután kiírja ,hogy mi a feladat madd dog EGYBŐL leugrik

 

előre


2014.10.30. 14:26 Idézet
valaki2

NO comment LUSIKAS:


2014.01.21 17:52
valaki2
kérlek segitsetek mien kodot kell beütni xbox ra hogy be tudjak tenni autot

2014.10.30. 14:24 Idézet
gtatagta

na itt vagyok Ja és nemkel megy csinálni a Z küldit ..::::!!!!!!!!!!


2010.07.22 18:47
Arpi

„San Fierroban muszaly megcsinalni a Z-t????/???? ”


2014.10.30. 14:19 Idézet
kula SEXXXX fakkk GE bal

Hol található cj csaja lasventurasban ::::::??????????? ?????????????????????


2014.10.30. 14:16 Idézet
CJ kefegép

gafiti rendőrre sok akkor baj van és kapsz 4 körözést


2014.10.30. 14:13 Idézet
Big Smoke vagyok dagadt Fos Kula

CJ tud SEX-elni amikor egy prosti a kocsidba beül és --akkor mozog a kocsi :?:?:?:?:?:?


[280-261] [260-241] [240-221] [220-201] [200-181] [180-161] [160-141] [140-121] [120-101] [100-81] [80-61] [60-41] [40-21] [20-1]

 
Menü
 
Extrák
 
Clock
 
Lélekszámláló
Indulás: 2008-09-08
 
Chat
Név:

Üzenet:
:)) :) :@ :? :(( :o :D ;) 8o 8p 8) 8| :( :'( ;D :$
 
Szavazz!!
Milyen az oldal?

Tök jó!!!
Jó..:)
Elmegy
Nem valami jó...
Szar
Szavazás állása
Lezárt szavazások
 
Kérések
 

INGYEN DESIGN KÉSZÍTÉS! NÉZZETEK BE! ;)    *****    5Gb Web tárhely 1Év-re 4990Ft . Napi adatmentéssel!!! 1Gbit-es internet kapcsolat!!! Vps Bérlés már 1990Ft-tól!!!    *****    Seed Szerver Akció, Seed Szerver Akció, Seed Szerver Akció, Seed Szerver Akció, Seed Szerver Akció, Seed Szerver Akció    *****    AZ ÉV (G-Portál) HONLAPJA 2014 - 3 nap van hátra a nevezésbõl, le ne maradj! Fõnyeremény: .hu-s domain! :)    *****    RONGYBABÁK GYÖNYÖRÛ-EGYEDI KIDOLGOZÁSSAL CSAK NÁLAM, ÚJRA!    *****    GIST - GIST -Nagyon egyedül vagyok - GIST - Nagyon egyedül vagyok - GIST - GIST - Nagyon egyedül vagyok - GIST - GIST    *****    E-book ingyen! Keira Christie: Alattam buli, felettem gyilkosság - izgalmas kriminovella, most ingyen e-könyvként!    *****    NEXTWORLD2 Magyarország ingyenes, nagysikerû MMORPG játéka. Gyertek játszani, írjuk együtt a Legendát! Kattintsatok!    *****    NEXTWORLD2 Magyarország ingyenes, nagysikerû MMORPG játéka. Gyertek játszani, írjuk együtt a Legendát! Kattintsatok!    *****    ÉHEZÕK VIADALA: KIVÁLASZTOTT I. RÉSZ A MOZIKBAN! JENNIFER LAWRENCE FÕSZERELPÉSÉVEL TÖBBET AKARSZ? KATTINTS NEM BÁNOD MEG    *****    John Scalzi: Bezárt elmék - most e-book formátumban beszerezhetõ.    *****    INGYEN E-BOOK! - Krisz Nádasi: Ki kopog, ki kopog? - Novella egy lányról és egy kisfiúról Mikulás idején. INGYEN E-BOOK!    *****    Homérosz: Iliász - egy õsi történet modern e-book formában, mindössze 100 Ft-ért!    *****    { BLOG } - He is not the sun. You are. -    *****    Gyere és nézz be a legújabb a Marvel Studióval és sztárjaival foglalkozó oldalra! Chris Evans, Robert Downey Jr....    *****    GIST GIST GIST GIST GIST GIST GIST GIST GIST GIST GIST GIST GIST GIST GIST GIST GIST GIST GIST GIST GIST GIST GIST GIST    *****    OUTLANDER-ONLINE.GP - DIANA GABALDON REGÉNYÉBÕL KÉSZÜLT SOROZAT LEGNAGYOBB RAJONGÓI OLDALA! OUTLANDER SOROZAT! KATT KATT    *****    *NOVEMBERI NYEREMÉNYJÁTÉK* "IDE MINDIG ÉRDEMES BENÉZNI!" Picur Mini ABC Nyitva:mindennap 5-21h-ig Bp. IV. Nádor u. 87    *****    Több kreditet szeretnél? Nevezz a téli rajzversenyre, írj egy történetet 3 megadott mondatból, és játssz a minijátékon!    *****    Nézd ingyen onlinen filmet, vagy már le is töltheted öket! Pllocker mozi. Keres a facebookon is!