G.T.A. San Andreas segítség a végigjátszásban :D Kódok, térképek, és sok érdekesség !!! + 2011-től GTA4 és Vice City !!
G.T.A. San Andreas segítség a végigjátszásban :D Kódok, térképek, és sok érdekesség !!! + 2011-től GTA4 és Vice City !!
San Andreas
 
Küldetések
 
GTA 4
 
Vice City
 
Liberty City Stories
 
Naptár
2015. Július
HKSCPSV
29
30
01
02
03
04
05
06
07
08
09
10
11
12
13
14
15
16
17
18
19
20
21
22
23
24
25
26
27
28
29
30
31
01
02
<<   >>
 
Bejelentkezés
Felhasználónév:

Jelszó:
SúgóSúgó
Regisztráció
Elfelejtettem a jelszót
 
Szavazz!
Azért vagyok itt...

...mert nem tudom végigvinni a játékot, kell segítség
...mert már végigvittem, de a 100% nem jön össze
...mert kíváncsi vagyok mit rejteget még a GTA
...mert véletlen rákattintottam erre
...mert unatkoztam
...mert jó a tarsaság
egyéb
Szavazás állása
Lezárt szavazások
 
Kérésed IDE ird!
[294-275] [274-255] [254-235] [234-215] [214-195] [194-175] [174-155] [154-135] [134-115] [114-95] [94-75] [74-55] [54-35] [34-15] [14-1]

2015.06.10. 17:24 Idézet
alexxx

Pont most vettem eszre.


2015.06.10. 17:23 Idézet
alexxx

Ez meg melyik marha volt??????


2015.06.10. 17:21 Idézet
gecik

dogoljetek meg ti kurvak!!!!!!!!!!!!!!!!!!!AAAAAAAAAAAAAAAHHHHHHHHHHHHHHHHH


2015.03.29. 08:20 Idézet
alex

En is rajottem Peti ,nem vettem eszre , hogy te irtad:D es megcsinaltad.


2015.03.29. 08:19 Idézet
alex

                                                    Kedves Peti

A gepet ne egybol emeld fel olyan magasra , hanem lassacskan.Egy picit emeld egy picit gyorsuljon fel es utana semmi eselye nem lesz , hogy lezuhanjon.Ha nem jol mondtam , akkor irj. 

                                                                                       


2015.03.29. 08:05 Idézet
alex

Nekem nem kell segitseg, csak nektek.:D

Ha van san andreas multiplayer-rel is gondotok azt is elfogadom.

                                                       Csak G.T.A!!!!!!!!!!!!      


2015.03.29. 08:02 Idézet
alex

Nem tudok ekezettel irni bocs.

En GTA San Andreas bolond vagyok , tehat en sok erdekesseget tudok ezzel kapcsolatba.

Szeretnek sok erdekesseget bemutatni a gta-val kapcsolatosan.Ha akartok sokmindent megtudni akkor csak irjatok .


2015.03.29. 07:58 Idézet

Sziasztok!!!!!                                          


2015.01.08. 18:28 Idézet
haljatok meg anyátokban ti kurvá

anyát o ka   t   er r ea  szarol da lg ec ivrebb v


2015.01.01. 19:35 Idézet
Sziasztok! Meg tudnátok nekem mondani hogy ps2-őn a két személyes piros jelet hol találom (azt amelyikben csak ugy vagyunk nem azt ahol öldösni kel az embereket)
2015.01.01 19:33
Máté
Sziasztok! Meg tudnátok nekem mondani hogy ps2-őn a két személyes piros jelet (azt. amelyikben csak ugy vagyunk nem azt ahol öldösni kel az embereket)

2015.01.01. 19:33 Idézet
Sziasztok! Meg tudnátok nekem mondani hogy ps2-őn a két személyes piros jelet (azt. amelyikben csak ugy vagyunk nem azt ahol öldösni kel az embereket)

2014.12.29. 14:23 Idézet
peti

Rájöttem hogy én voltam a buta, nem húztam vissza a kerekeket felszállás után...


2014.12.29 09:10
Peti

„ Sziasztok!

 

A repülőiskolánál elakagtam, az első 2 feladat megvan azonban a 3adiknál közvetlenül felszállás után egyszerűen nem tudom olyan magasra juttatni a gépet hogy elérje a karikát kb a magasság feléig jutok, amikor a gép motorja elkezd fulladozni és nem emelkedik tovább.

Már próbáltam extragyorsan és extralassan is az emelkedést de akkor is csak ugyanaddig emelkedik a gép...

Ki nem állhatom amúgy a repülős küldetéseket, kár hogy e nélkül nem lehet tovább vinni a kalandsort...


2014.12.29. 09:10 Idézet
Peti

Sziasztok!

 

A repülőiskolánál elakagtam, az első 2 feladat megvan azonban a 3adiknál közvetlenül felszállás után egyszerűen nem tudom olyan magasra juttatni a gépet hogy elérje a karikát kb a magasság feléig jutok, amikor a gép motorja elkezd fulladozni és nem emelkedik tovább.

Már próbáltam extragyorsan és extralassan is az emelkedést de akkor is csak ugyanaddig emelkedik a gép...

Ki nem állhatom amúgy a repülős küldetéseket, kár hogy e nélkül nem lehet tovább vinni a kalandsort...


2014.12.27. 10:26 Idézet

Sziasztok!

olyan kérdésem lenne, hogy amikor torino-z kiszabadítom és a limoval kell menni, nekem a híd alá jelöli hogy menni kell amikor ott vagyok a piros karika eltűnik de a sárga jel ott marad és nem jelez tovább utat,, ott mit kell csinálni?


2014.11.10. 15:09 Idézet
kurva

kol tali gokartiak mi te kocsog gtagtagta pusztulj el te rokadt kurifasz


2014.11.08. 00:57 Idézet

Figyu hol találhato a gokart


2014.11.08. 00:51 Idézet

Figyu hol találhato a gokart


2014.10.31. 14:04 Idézet
gtttttttaaaagtttaagggggttttttaaa

fak cj


2014.10.31. 14:02 Idézet
prosti,állatok,vagytok,

sex cj kocsi  mozog


2014.10.31. 13:53 Idézet
gtagtagta

cj

 

 

ridy bigismok

ingsvetterson


[294-275] [274-255] [254-235] [234-215] [214-195] [194-175] [174-155] [154-135] [134-115] [114-95] [94-75] [74-55] [54-35] [34-15] [14-1]

 
Menü
 
Extrák
 
Clock
 
Lélekszámláló
Indulás: 2008-09-08
 
Chat
Név:

Üzenet:
:)) :) :@ :? :(( :o :D ;) 8o 8p 8) 8| :( :'( ;D :$
 
Szavazz!!
Milyen az oldal?

Tök jó!!!
Jó..:)
Elmegy
Nem valami jó...
Szar
Szavazás állása
Lezárt szavazások
 
Kérések
 

A Pokol kapui a könnyû hozzáférhetõség és kényelem érdekében a Földre kerültek. - Springdale Szerepjáték. Ne nézz hátra.    *****    A Pokol kapui a könny&#251; hozzáférhet&#245;ség és kényelem érdekében a Földre kerültek. - Springdale Szerepjáték. Ne nézz hátra.    *****    SZEREPJÁTÉK - SHELTER HOUSE újra nyitva, téged is vár a menedékház! - SZEREPJÁTÉK - SHELTER HOUSE - A menedékház    *****    University of Oxford Roleplay - az álomegyetem, ahol minden megtörténhet; és meg is történik    *****    CHRIS EVANS DAILY - Az elsõ számú magyar Chris Evans rajongói oldal    *****    Szeretnél pénzt keresni? Klikk ide mindenki! KLIKK! KLIKK! KLIKK!    *****    Fél évesek lettünk, új kinézettel ünneplünk! Nézz be hozzánk, kíváncsiak vagyunk a véleményedre! Nézz be hozzánk még ma!    *****    Szeretnél pénzt keresni a Facebook oldaladdal, vagy a fb csoportoddal, weboldaladdal, blogoddal is! Nem kamu! Nem MLM!!!    *****    Megnyílt Magyarország legújabb 1D rajongói oldala, a OneDirectionFans! Gyertek és ismerjétek meg az együttest! &#9829;&#9829; 1D &#9829;&#9829;    *****    MAGYARORSZÁG JELENLEG EGYETLEN AKTÍV OLICITY ÉS ARROW RAJONGÓI OLDALA! MINDEN NAP FRISS TUDJ MEG MINDENT KEDVENCEIDRÕL!    *****    Újra üzemel Magyarország egyetlen Meryem Uzerlivel foglalkozó oldala! Nézz be, hogy elsõként értesülj a friss hírekrõl!    *****    # ELADÓ CUCCAIM // könyvek, minikönyvek, kozmetikumok, bélyegek, ruhák, hajvasaló, mobiltelefon, táskák // NÉZZ BE :) #    *****    Több Ezer Fantasy Kép:amazonok,angyalok,vámpírok,szörnyek,stb.Online-Teljes Filmek:fantasy,horror,romantika,vígjáték,stb    *****    **JÚLIUSI NYEREMÉNYJÁTÉK** "IDE MINDIG ÉRDEMES BENÉZNI!" Picur Mini ABC Nyitva:mindennap 5-21h-ig Bp. IV. Nádor u. 87    *****    SJ 4000 FULL HD akciókamera tartozékokkal, újonnan, garanciával - 20.890 Ft-ért    *****    A Pokol kapui a könnyû hozzáférhetõség és kényelem érdekében a Földre kerültek. - Springdale Szerepjáték. Ne nézz hátra.    *****    MINNIE-BLOG (ÚJ OLDAL) amely õszinte bejegyzéseket tartalmaz az élet dolgairól.    *****    SELENA GOMEZ | MAGYARORSZÁG EGYETLEN SELENA GOMEZ OLDALA | GOOD FOR YOU | ÚJ DESIGN | SELENA GOMEZ SELENA GOMEZ SG SG SG    *****    Gyere és játsz! Minden 100. regisztráló megnyeri az 500.000 forintot! Gyere és vidd el te a pénzt!!!    *****    MARC MARQUEZ HUNGARY - Magyarország egyetlen Marc Marquezzel foglalkozó rajongói oldala. Nézz be!