G.T.A. San Andreas segítség a végigjátszásban :D Kódok, térképek, és sok érdekesség !!! + 2011-től GTA4 és Vice City !!
G.T.A. San Andreas segítség a végigjátszásban :D Kódok, térképek, és sok érdekesség !!! + 2011-től GTA4 és Vice City !!
San Andreas
 
Küldetések
 
GTA 4
 
Vice City
 
Liberty City Stories
 
Naptár
2014. December
HKSCPSV
01
02
03
04
05
06
07
08
09
10
11
12
13
14
15
16
17
18
19
20
21
22
23
24
25
26
27
28
29
30
31
01
02
03
04
<<   >>
 
Bejelentkezés
Felhasználónév:

Jelszó:
SúgóSúgó
Regisztráció
Elfelejtettem a jelszót
 
Szavazz!
Azért vagyok itt...

...mert nem tudom végigvinni a játékot, kell segítség
...mert már végigvittem, de a 100% nem jön össze
...mert kíváncsi vagyok mit rejteget még a GTA
...mert véletlen rákattintottam erre
...mert unatkoztam
...mert jó a tarsaság
egyéb
Szavazás állása
Lezárt szavazások
 
Kérésed IDE ird!
[280-261] [260-241] [240-221] [220-201] [200-181] [180-161] [160-141] [140-121] [120-101] [100-81] [80-61] [60-41] [40-21] [20-1]

2014.11.10. 15:09 Idézet
kurva

kol tali gokartiak mi te kocsog gtagtagta pusztulj el te rokadt kurifasz


2014.11.08. 00:57 Idézet

Figyu hol találhato a gokart


2014.11.08. 00:51 Idézet

Figyu hol találhato a gokart


2014.10.31. 14:04 Idézet
gtttttttaaaagtttaagggggttttttaaa

fak cj


2014.10.31. 14:02 Idézet
prosti,állatok,vagytok,

sex cj kocsi  mozog


2014.10.31. 13:53 Idézet
gtagtagta

cj

 

 

ridy bigismok

ingsvetterson


2014.10.31. 13:49 Idézet
rozsradekasdáélaskihf

hali én vagyok az ÚJ segitségg.


2014.10.30. 14:42 Idézet
lázsló2

fakk kula tudja


2009.06.07 11:57
Závoczki Lászlo

„Helloa kérdésem az lenne: hol található ''Ds'' nevű ruhabolt?”


2014.10.30. 14:41 Idézet
kitreeeeas

lúúúúzer vagy!!!!!!!


2014.07.05 19:31
dragalaslo

„ Sziasztok! Az lenne a kérdésem, hogy miért történik az, hogy nincs meg San Fierro-ban az összes fénykép helye, La Venturas-ban nincs meg egy patkó. 2.00-s eredeti lemezes SA-m van... köszönöm a választ előre is! :)


2014.10.30. 14:39 Idézet
kirtadsvwstzd

gtagtagta fos kula vagy


2014.10.30. 14:37 Idézet
fak gta

gtagtagta nem írsz senki üziére


2014.10.30. 14:35 Idézet
gtagtagta

LUZI vagy hülyeségeket irsz


2009.06.02 15:14
gtagtagta

„az éttermek helye című menüpontban minden nagy helynév szerepel”


2014.10.30. 14:34 Idézet
senkiházi

hülyeségeket ÍÍÍÍrssszzzzz


2009.06.02 15:12
gtagtagta

„mondjuk a menüpontoknak felében. xD”


2014.10.30. 14:32 Idézet
kula prosti taálakula

várd meg még beül egy prosti melléd és lassan menjél .....................???????++++++++!!!!!!!!%+Z%/%//+%!+


2014.10.30. 14:29 Idézet
hunter59 mása hülyeség

ja nem tudom me mert már azt kiakasztottam    


2010.05.29 17:43
hunter59

„segítsetek! a madd dog-os küldinél miután kiírja ,hogy mi a feladat madd dog EGYBŐL leugrik

 

előre


2014.10.30. 14:26 Idézet
valaki2

NO comment LUSIKAS:


2014.01.21 17:52
valaki2
kérlek segitsetek mien kodot kell beütni xbox ra hogy be tudjak tenni autot

2014.10.30. 14:24 Idézet
gtatagta

na itt vagyok Ja és nemkel megy csinálni a Z küldit ..::::!!!!!!!!!!


2010.07.22 18:47
Arpi

„San Fierroban muszaly megcsinalni a Z-t????/???? ”


2014.10.30. 14:19 Idézet
kula SEXXXX fakkk GE bal

Hol található cj csaja lasventurasban ::::::??????????? ?????????????????????


2014.10.30. 14:16 Idézet
CJ kefegép

gafiti rendőrre sok akkor baj van és kapsz 4 körözést


2014.10.30. 14:13 Idézet
Big Smoke vagyok dagadt Fos Kula

CJ tud SEX-elni amikor egy prosti a kocsidba beül és --akkor mozog a kocsi :?:?:?:?:?:?


[280-261] [260-241] [240-221] [220-201] [200-181] [180-161] [160-141] [140-121] [120-101] [100-81] [80-61] [60-41] [40-21] [20-1]

 
Menü
 
Extrák
 
Clock
 
Lélekszámláló
Indulás: 2008-09-08
 
Chat
Név:

Üzenet:
:)) :) :@ :? :(( :o :D ;) 8o 8p 8) 8| :( :'( ;D :$
 
Szavazz!!
Milyen az oldal?

Tök jó!!!
Jó..:)
Elmegy
Nem valami jó...
Szar
Szavazás állása
Lezárt szavazások
 
Kérések
 

HONLAPVERSENY! Fõdíj 1.000 kredit! HONLAPVERSENY! Fõdíj 1.000 kredit! HONLAPVERSENY! Fõdíj 1.000 kredit! HONLAPVERSENY!    *****    THE FLASH - MAGYAR FANSITE: HÍREK, FELIRATOS VIDEÓK, HÁTTÉR-INFÓK, KÉPEK - ISMERKEDJ MEG A CW LEGNÉZETTEBB SOROZATÁVAL!!    *****    A Rébusz elkezdõdött! Agyalj, és nyerj 2db Cinema City Ajándékjegyet, és sok-sok kreditet! Mire vársz? :)    *****    FRINCA ÚJDONSÜLT BLOGJA, TELE ÉRZELMEKKEL! MERT MESÉLNEM KELL!    *****    Scared to Death - Horror film kritikák a klasszikusoktól a mai premierekig.Mit érdemes megnézni?Mit nem?Derítsd ki most!    *****    A LEGNAPRAKÉSZEBB ÉS LEGTARTALMASABB MAGYAR MARILYN MANSON OLDAL! NÉZD MEG AZ ÚJ KLIPPET ÉS TÖLTSD LE AZ ÚJ ALBUMOT!    *****    Közeledik a karácsony. Magányosnak érzed magad? Gyere és beszélgessünk.    *****    ÚJ BLOG-OLDAL NYÍLT, TELE ÉRZELMEKKEL! MERT KI KELL MONDANI MINDENT, AMI A SZÍVEDBEN VAN!    *****    THE FLASH RAJONGÓI OLDAL! TÁRSOLDALAKAT KERESÜNK! FO.:FILMMEL VAGY SOROZATTAL KAPCS. LEGYEN! ÍRJ A V.K.-BA!    *****    Szeretnél 2db Cinema City Ajándékjegyet, vagy kreditre vágysz? Játssz a Rébusz Reboot játékon, és nyerj!    *****    KATTINTS A GPORTAL EGYETLEN JENNIFER LAWRENCE-EL FOGLALKOZÓ OLDALÁRA! KATTINTS ISMERD MEG AZ ÉHEZÕK VIADALA SZTÁRJÁT!    *****    Oszd meg Youtube kedvenc videóidat, filmjeidet! zenéidet mind ez regisztráció nélkül! klikk és oszd!    *****    Bûbájos boszorkák - Versenyek, mágia, boszorkányság, játékok és még több extra! Érdemes benézni minden nap! CHARMED!!!    *****    Web Tárhely -50% Kedvzménnyel!!! 1Gb tárhely 1500Ft/Év, 5Gb tárhely 3000Ft/Év, 20Gb tár 8000Ft/Év. CSAK DECEMBER 31.-ig.    *****    *DECEMBERBEN DUPLA SORSOLÁS*"IDE MINDIG ÉRDEMES BENÉZNI!" Picur Mini ABC Nyitva: mindennap 5-21h-ig Bp. IV. Nádor u. 87.    *****    Ha érdekel nézz be. Egy új oldal, ami blog témában mozog. Saját gondolataim és egyéb dolgok.    *****    Ha szeretnéd hogy weboldalad és facebook oldalad bevételt hozzon akkor itt a lehetõség hogy pénzt keres. klikk infó!!!    *****    The Originals| Szeretnél nyerni sok kreditet, akkor ma este 9 órakor itt a helyed, gyere és keress kreditkódokat! :D    *****    Keres pénzt saját látogatóiddal!Helyezz el hirdetéseket amelyekkel bevételhez jutsz!Gyere és kerres pénzt weboldaladdal!    *****    Karácsonyi ajándék