G.T.A. San Andreas segítség a végigjátszásban :D Kódok, térképek, és sok érdekesség !!! + 2011-től GTA4 és Vice City !!
G.T.A. San Andreas segítség a végigjátszásban :D Kódok, térképek, és sok érdekesség !!! + 2011-től GTA4 és Vice City !!
San Andreas
 
Küldetések
 
GTA 4
 
Vice City
 
Liberty City Stories
 
Naptár
2015. Február
HKSCPSV
26
27
28
29
30
31
01
02
03
04
05
06
07
08
09
10
11
12
13
14
15
16
17
18
19
20
21
22
23
24
25
26
27
28
01
<<   >>
 
Bejelentkezés
Felhasználónév:

Jelszó:
SúgóSúgó
Regisztráció
Elfelejtettem a jelszót
 
Szavazz!
Azért vagyok itt...

...mert nem tudom végigvinni a játékot, kell segítség
...mert már végigvittem, de a 100% nem jön össze
...mert kíváncsi vagyok mit rejteget még a GTA
...mert véletlen rákattintottam erre
...mert unatkoztam
...mert jó a tarsaság
egyéb
Szavazás állása
Lezárt szavazások
 
Kérésed IDE ird!
[286-267] [266-247] [246-227] [226-207] [206-187] [186-167] [166-147] [146-127] [126-107] [106-87] [86-67] [66-47] [46-27] [26-7] [6-1]

2015.01.08. 18:28 Idézet
haljatok meg anyátokban ti kurvá

anyát o ka   t   er r ea  szarol da lg ec ivrebb v


2015.01.01. 19:35 Idézet
Sziasztok! Meg tudnátok nekem mondani hogy ps2-őn a két személyes piros jelet hol találom (azt amelyikben csak ugy vagyunk nem azt ahol öldösni kel az embereket)
2015.01.01 19:33
Máté
Sziasztok! Meg tudnátok nekem mondani hogy ps2-őn a két személyes piros jelet (azt. amelyikben csak ugy vagyunk nem azt ahol öldösni kel az embereket)

2015.01.01. 19:33 Idézet
Sziasztok! Meg tudnátok nekem mondani hogy ps2-őn a két személyes piros jelet (azt. amelyikben csak ugy vagyunk nem azt ahol öldösni kel az embereket)

2014.12.29. 14:23 Idézet
peti

Rájöttem hogy én voltam a buta, nem húztam vissza a kerekeket felszállás után...


2014.12.29 09:10
Peti

„ Sziasztok!

 

A repülőiskolánál elakagtam, az első 2 feladat megvan azonban a 3adiknál közvetlenül felszállás után egyszerűen nem tudom olyan magasra juttatni a gépet hogy elérje a karikát kb a magasság feléig jutok, amikor a gép motorja elkezd fulladozni és nem emelkedik tovább.

Már próbáltam extragyorsan és extralassan is az emelkedést de akkor is csak ugyanaddig emelkedik a gép...

Ki nem állhatom amúgy a repülős küldetéseket, kár hogy e nélkül nem lehet tovább vinni a kalandsort...


2014.12.29. 09:10 Idézet
Peti

Sziasztok!

 

A repülőiskolánál elakagtam, az első 2 feladat megvan azonban a 3adiknál közvetlenül felszállás után egyszerűen nem tudom olyan magasra juttatni a gépet hogy elérje a karikát kb a magasság feléig jutok, amikor a gép motorja elkezd fulladozni és nem emelkedik tovább.

Már próbáltam extragyorsan és extralassan is az emelkedést de akkor is csak ugyanaddig emelkedik a gép...

Ki nem állhatom amúgy a repülős küldetéseket, kár hogy e nélkül nem lehet tovább vinni a kalandsort...


2014.12.27. 10:26 Idézet

Sziasztok!

olyan kérdésem lenne, hogy amikor torino-z kiszabadítom és a limoval kell menni, nekem a híd alá jelöli hogy menni kell amikor ott vagyok a piros karika eltűnik de a sárga jel ott marad és nem jelez tovább utat,, ott mit kell csinálni?


2014.11.10. 15:09 Idézet
kurva

kol tali gokartiak mi te kocsog gtagtagta pusztulj el te rokadt kurifasz


2014.11.08. 00:57 Idézet

Figyu hol találhato a gokart


2014.11.08. 00:51 Idézet

Figyu hol találhato a gokart


2014.10.31. 14:04 Idézet
gtttttttaaaagtttaagggggttttttaaa

fak cj


2014.10.31. 14:02 Idézet
prosti,állatok,vagytok,

sex cj kocsi  mozog


2014.10.31. 13:53 Idézet
gtagtagta

cj

 

 

ridy bigismok

ingsvetterson


2014.10.31. 13:49 Idézet
rozsradekasdáélaskihf

hali én vagyok az ÚJ segitségg.


2014.10.30. 14:42 Idézet
lázsló2

fakk kula tudja


2009.06.07 11:57
Závoczki Lászlo

„Helloa kérdésem az lenne: hol található ''Ds'' nevű ruhabolt?”


2014.10.30. 14:41 Idézet
kitreeeeas

lúúúúzer vagy!!!!!!!


2014.07.05 19:31
dragalaslo

„ Sziasztok! Az lenne a kérdésem, hogy miért történik az, hogy nincs meg San Fierro-ban az összes fénykép helye, La Venturas-ban nincs meg egy patkó. 2.00-s eredeti lemezes SA-m van... köszönöm a választ előre is! :)


2014.10.30. 14:39 Idézet
kirtadsvwstzd

gtagtagta fos kula vagy


2014.10.30. 14:37 Idézet
fak gta

gtagtagta nem írsz senki üziére


2014.10.30. 14:35 Idézet
gtagtagta

LUZI vagy hülyeségeket irsz


2009.06.02 15:14
gtagtagta

„az éttermek helye című menüpontban minden nagy helynév szerepel”


2014.10.30. 14:34 Idézet
senkiházi

hülyeségeket ÍÍÍÍrssszzzzz


2009.06.02 15:12
gtagtagta

„mondjuk a menüpontoknak felében. xD”


2014.10.30. 14:32 Idézet
kula prosti taálakula

várd meg még beül egy prosti melléd és lassan menjél .....................???????++++++++!!!!!!!!%+Z%/%//+%!+


[286-267] [266-247] [246-227] [226-207] [206-187] [186-167] [166-147] [146-127] [126-107] [106-87] [86-67] [66-47] [46-27] [26-7] [6-1]

 
Menü
 
Extrák
 
Clock
 
Lélekszámláló
Indulás: 2008-09-08
 
Chat
Név:

Üzenet:
:)) :) :@ :? :(( :o :D ;) 8o 8p 8) 8| :( :'( ;D :$
 
Szavazz!!
Milyen az oldal?

Tök jó!!!
Jó..:)
Elmegy
Nem valami jó...
Szar
Szavazás állása
Lezárt szavazások
 
Kérések
 

Frissen indult babablog kezdõ anyukáknak, babát tervezõknek. Tudd meg mi vár rád, hogyan készülj!    *****    **FEBRUÁRI NYEREMÉNYJÁTÉK** "IDE MINDIG ÉRDEMES BENÉZNI!" Picur Mini ABC Nyitva:mindennap 5-21h-ig Bp. IV. Nádor u. 87    *****    Ha szereted a filmeket, sorozatokat akkor itt a helyed! Nézd ingyen onlinen filmet! Már androidos készüléken is! KLIKK!!    *****    Nézz be hozzánk ha jobban megszeretnéd ismerni a The Originals sorozat Davináját alakító színésznõt!    *****    Honlapverseny!! 100 kredit a nyeremény!! Jelentkezz te is!!! 100 kreditet nyerhetsz!! Honlapverseny!! Jelentkezz!!!    *****    THE FLASH MAGYAR OLDAL - HÍREK, INFORMÁCIÓK, HÁTTÉR-TÖRTÉNETEK, FELIRATOS VIDEÓK, LETÖLTÉSEK, KÉPEK, TEÓRIÁK - THE FLASH    *****    GABY ESPINO- Gyere és nézz be a nemrég nyílt Gaby Espino Hungaryt! Tartalmas, szép és rengeteg kép vár! - GABY ESPINO    *****    FROZENWEB.FLAUNT.NU | FROZENWEB.FLAUNT.NU | FROZENWEB.FLAUNT.NU | FROZENWEB.FLAUNT.NU | FROZENWEB.FLAUNT.NU    *****    THE FLASH MAGYAR OLDAL - HÍREK, INFORMÁCIÓK, HÁTTÉR-TÖRTÉNETEK, FELIRATOS VIDEÓK, LETÖLTÉSEK, KÉPEK, TEÓRIÁK - THE FLASH    *****    Szereted a PÓKER-t? Gyere és játsz te is. Vagy töltsd le a telefonodra a Póker alkalmazást. 1000Ft Kezdõ tõke!!!    *****    MARILYN MANSON elsõ számú, legnaprakészebb magyar rajongói oldala! Rendeld elõ az új albumot most csak 2990 Ft-ért! KATT    *****    Keress pénzt saját látogatóiddal! Helyezz el hirdetéseket, amikkel egybõl kereshetsz!    *****    Keress pénzt sajátlátogatóiddal! Helyezz el hirdetéseket, amikkel egybõl kereshetsz!    *****    Minimálbér 2016 - minimálbér és garantált bérminimum összege 2016 - katt ide    *****    Új design Magyarország hivatalos Meryem Uzerlivel foglalkozó oldalán! Ha szereted a színésznõt, KATT!    *****    Minden emberben egy csillag ragyog. Nézz be ehhez a pici csillaghoz, talán nem bánod meg :)    *****    SELENA GOMEZ &#8211; LÁTOGASS EL MAGYARORSZÁG LEGAKTÍVABB SELENA GOMEZZEL FOGLALKOZÓ OLDALÁRA! - MEGÚJULT KÜLSÕVEL!!    *****    Szeretsz PÓKER ezni? Gyere és játsz te is. Vagy töltsd le a telefonodra a Póker alkalmazást. Belépés után a profilodnál    *****    Megnyitotta kapuit a CW-Reign.gportal.hu! | CW-Reign.gportal.hu    *****    Honlapverseny!! 100 kredit a nyeremény!! Jelentkezz te is!!! 100 kreditet nyerhetsz!! Honlapverseny!! Jelentkezz!!!